pDONR207-MUM2sp-RglA
(Plasmid
#170720)
-
PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the coding sequence of the RG-I degrading enzyme RglA (AN7135.2)
-
Depositing Lab
-
Depositing OrganizationUniversity of British Columbia
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5585
- Total vector size (bp) 4994
-
Vector typeGateway Donor vector / entry clone
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor selection use 7 ug/ml Gentamicin
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRhamnogalacturonan lyase A
-
Alt nameRglA
-
Alt nameAN7135.2
-
Alt nameQ5AX45 (Uniprot)
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1520
-
GenBank IDDQ490504
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer TAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use with Three-way Multi-site Gateway Cloning (Invitrogen).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207-MUM2sp-RglA was a gift from George Haughn (Addgene plasmid # 170720 ; http://n2t.net/addgene:170720 ; RRID:Addgene_170720) -
For your References section:
Pectin Modification in Seed Coat Mucilage by In Vivo Expression of Rhamnogalacturonan-I- and Homogalacturonan-Degrading Enzymes. McGee R, Dean GH, Wu D, Zhang Y, Mansfield SD, Haughn GW. Plant Cell Physiol. 2021 Jun 1. pii: 6290394. doi: 10.1093/pcp/pcab077. 10.1093/pcp/pcab077 PubMed 34059917