Skip to main content

pE5770
(Plasmid #170777)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170777 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    custom
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 3977
  • Total vector size (bp) 5128
  • Vector type
    Bacterial Expression
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kan resistance
  • Alt name
    KanR
  • Entrez Gene
    kanR (a.k.a. peH4H_0130)
  • Promoter T7
  • Tag / Fusion Protein
    • polyhisbioMbpTEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site Xba1/HindIII (unknown if destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Not sure. Have been making custom plasmids for over 35 years and cannot readily trace the original sources of all components in the old plasmids.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pE5770 was a gift from Anthony Schryvers (Addgene plasmid # 170777 ; http://n2t.net/addgene:170777 ; RRID:Addgene_170777)
  • For your References section:

    Design and Production of Hybrid Antigens for Targeting Integral Outer Membrane Proteins in Gram-Negative Bacteria. Chaudhuri S, Ewasechko NF, Samaniego-Barron L, Fegan JE, Schryvers AB. Methods Mol Biol. 2022;2414:115-140. doi: 10.1007/978-1-0716-1900-1_8. 10.1007/978-1-0716-1900-1_8 PubMed 34784035