Tbx21 gRNA#1
(Plasmid
#170837)
-
PurposeCas9-mediated knockout of Tbx21 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyushu University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 170837-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 170837-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonegRNA backbone
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTbx21
-
gRNA/shRNA sequenceGACCCGACCGATCGCCGCGCAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneTbx21 (a.k.a. TBT1, Tbet, Tblym)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 170837-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 170837-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tbx21 gRNA#1 was a gift from Takeshi Imai (Addgene plasmid # 170837 ; http://n2t.net/addgene:170837 ; RRID:Addgene_170837) -
For your References section:
BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Aihara S, Fujimoto S, Sakaguchi R, Imai T. Cell Rep. 2021 Jun 22;35(12):109276. doi: 10.1016/j.celrep.2021.109276. 10.1016/j.celrep.2021.109276 PubMed 34161760