Skip to main content

pAAV-Ef1a-fDIO-ChrimsonR-tdTomato
(Plasmid and Viral Vector Preps for #171027)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171027 Standard format: Plasmid sent in bacteria as agar stab 1 $94
AAV1 171027-AAV1 Limited Stock Available, 2 units left
Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$459
AAV9 171027-AAV9 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $459

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Ef1a-fDIO
  • Backbone manufacturer
    Addgene # 55641
  • Backbone size w/o insert (bp) 6323
  • Modifications to backbone
    EYFP cDNA removed by AscI-NheI double digest
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChrimsonR-tdTomato
  • Species
    Synthetic
  • Insert Size (bp)
    2496
  • Promoter Ef1a
  • Tag / Fusion Protein
    • ChrimsonR is fused to tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer GTTAGGCCAGCTTGGCACTTGATG
  • 3′ sequencing primer CAAAGGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChrimsonR-tdTomato fusion was isolated from Addgene #62723
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA.

Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.

Purpose

Ready-to-use AAV9 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA.

Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-fDIO-ChrimsonR-tdTomato was a gift from Patricia Jensen (Addgene plasmid # 171027 ; http://n2t.net/addgene:171027 ; RRID:Addgene_171027) For viral preps, please replace (Addgene plasmid # 171027) in the above sentence with: (Addgene viral prep # 171027-AAV1) or (Addgene viral prep # 171027-AAV9)
  • For your References section:

    Natural locus coeruleus dynamics during feeding. Sciolino NR, Hsiang M, Mazzone CM, Wilson LR, Plummer NW, Amin J, Smith KG, McGee CA, Fry SA, Yang CX, Powell JM, Bruchas MR, Kravitz AV, Cushman JD, Krashes MJ, Cui G, Jensen P. Sci Adv. 2022 Aug 19;8(33):eabn9134. doi: 10.1126/sciadv.abn9134. Epub 2022 Aug 19. 10.1126/sciadv.abn9134 PubMed 35984878