pQ-Elo-HB-C-A(1-630)
(Plasmid
#171086)
-
PurposeCo-expresses of ΔC-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOB
-
Depositing Lab
-
Depositing OrganizationStowers Institute for Medical Research
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQE-2
- Total vector size (bp) 8085
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameElongin B
-
Alt nameTCEB2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)357
-
GenBank IDNM_007108.3
-
Entrez GeneELOB (a.k.a. SIII, TCEB2)
- Promoter T5 promoter
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameElongin C
-
Alt nameTCEB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)339
-
GenBank IDNM_001204857.1
-
Entrez GeneELOC (a.k.a. SIII, TCEB1)
- Promoter T5 promoter
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameElongin A
-
Alt nameTCEB3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1893
-
MutationDeleted N-term 26aa and C-term 142aa for mutant expression purpose.
-
GenBank IDA0A024RAC6
-
Entrez GeneELOA (a.k.a. ELOA1, SIII, SIII p110, TCEB3, TCEB3A)
- Promoter T5 promoter
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQ-Elo-HB-C-A(1-630) was a gift from Joan Conaway (Addgene plasmid # 171086 ; http://n2t.net/addgene:171086 ; RRID:Addgene_171086) -
For your References section:
Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872