pPPC005
(Plasmid
#171140)
-
PurposeFor integration of XylS-Pm-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T method
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepPPC001
-
Backbone manufacturerJesse Zalatan
- Backbone size w/o insert (bp) 10153
- Total vector size (bp) 11726
-
Modifications to backboneReplace Sp.pCas9 promoter with XylS-Pm
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlso resistant to Ampicillin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXylS-Pm
-
SpeciesP. putida
-
Insert Size (bp)2116
- Promoter Pm
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer accgaacaggcttatgtcaa
- 3′ sequencing primer CGAGTCGCTTCCGCTGTCTCTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPablo Ivan Nikel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative names: pCK193, pUC18TminiTn7T-Gm_XylS-Pm-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate XylS-Pm-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.
Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPPC005 was a gift from Jesse Zalatan (Addgene plasmid # 171140 ; http://n2t.net/addgene:171140 ; RRID:Addgene_171140) -
For your References section:
Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546