pPPC005
(Plasmid #171140)

• Purpose: For integration of XylS-Pm-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T method
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002.

Backbone

• Vector backbone: pPPC001
• Backbone manufacturer: Jesse Zalatan
• Backbone size w/o insert (bp): 10153
• Total vector size (bp): 11726
• Modifications to backbone: Replace Sp.pCas9 promoter with XylS-Pm
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Also resistant to Ampicillin
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: XylS-Pm
• Species: P. putida
• Insert Size (bp): 2116
• Promoter: Pm

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: accgaacaggcttatgtcaa
• 3′ sequencing primer: CGAGTCGCTTCCGCTGTCTCTCC

Resource Information

• Supplemental Documents:
  • pPPC005.gbk
• A portion of this plasmid was derived from a plasmid made by: Pablo Ivan Nikel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative names: pCK193, pUC18TminiTn7T-Gm_XylS-Pm-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate XylS-Pm-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.

Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255