pGEMHE-GST-KASH5-DN
(Plasmid
#171493)
-
PurposeT7 promotor drives in vitro transcription of GST-tagged bovine Kash5 DN mRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEHME
-
Vector typepGEHME
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKASH5-DN
-
Alt nameCCDC155
-
SpeciesB. tarus (bovine)
-
Entrez GeneCCDC155
- Promoter T7
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer M13: GTAAAACGACGGCCAGT
- 3′ sequencing primer GGCTACATTTTGGGGGACAACATTTTGTAAAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dominant negative version of bovine KASH5 (amino acids 482-524) that blocks the function of the LINC complex.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-GST-KASH5-DN was a gift from Melina Schuh (Addgene plasmid # 171493 ; http://n2t.net/addgene:171493 ; RRID:Addgene_171493) -
For your References section:
Parental genome unification is highly error-prone in mammalian embryos. Cavazza T, Takeda Y, Politi AZ, Aushev M, Aldag P, Baker C, Choudhary M, Bucevicius J, Lukinavicius G, Elder K, Blayney M, Lucas-Hahn A, Niemann H, Herbert M, Schuh M. Cell. 2021 Apr 30. pii: S0092-8674(21)00492-X. doi: 10.1016/j.cell.2021.04.013. 10.1016/j.cell.2021.04.013 PubMed 33964210