Skip to main content
Addgene
Open Menu

AAVS1-Puro CAG J591-scFV T-CAR
(Plasmid #171961)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171961 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 171961-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 171961-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Addgene Plasmid #136934
  • Backbone size w/o insert (bp) 10225
  • Total vector size (bp) 12122
  • Vector type
    Mammalian Expression, CRISPR, TALEN, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic J591-scFV CAR
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1897
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer gctaaccatgttcatgccttc
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Puro CAG J591-scFV T-CAR was a gift from Xiaoping Bao (Addgene plasmid # 171961 ; http://n2t.net/addgene:171961 ; RRID:Addgene_171961)

  • For your References section:

    Engineered anti-prostate cancer CAR-neutrophils from human pluripotent stem cells. Harris JD, Chang Y, Syahirah R, Lian XL, Deng Q, Bao X. J Immunol Regen Med. 2023 May;20:100074. doi: 10.1016/j.regen.2023.100074. Epub 2023 Apr 1. 10.1016/j.regen.2023.100074 PubMed 37089616
Related items:
Commonly requested with: