Skip to main content

pAAV-EF1a-FRT-EBFP-tTAn
(Plasmid #172127)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172127 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Ef1a-fDIO EYFP
  • Backbone manufacturer
    Addgene(#55641)
  • Backbone size w/o insert (bp) 5590
  • Vector type
    AAV
  • Selectable markers
    EBFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EBFP, tTAn-InteinN
  • Species
    Synthetic
  • Insert Size (bp)
    1692
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcacttgatgtaattctcc
  • 3′ sequencing primer gcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EBFP from AAV pmSyn1-EBFP-Cre(Addgene #51507), tTAN from pAAV-TRE-fDIO-GFP-IRES-tTA(Addgene #118026), InteinN from pLKO-GFP-IntN-ddFKBP (An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function. Deng Pan, et al. Sci Rep, 2016. 6: p. 26167.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Used Infusion cloning. 5' cloning site: AscI (not destroyed), 3' cloning site: NheI (not destroyed). Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438407v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FRT-EBFP-tTAn was a gift from Chun Xu (Addgene plasmid # 172127 ; http://n2t.net/addgene:172127 ; RRID:Addgene_172127)
  • For your References section:

    An intein-split transactivator for intersectional neural imaging and optogenetic manipulation. Chen HS, Zhang XL, Yang RR, Wang GL, Zhu XY, Xu YF, Wang DY, Zhang N, Qiu S, Zhan LJ, Shen ZM, Xu XH, Long G, Xu C. Nat Commun. 2022 Jun 23;13(1):3605. doi: 10.1038/s41467-022-31255-x. 10.1038/s41467-022-31255-x PubMed 35739125