pRSFDuet1-His-TEV-OTC_Ub
(Plasmid
#172134)
-
PurposeScaffold design for studying ubiquitin interacting proteins by cryo-EM.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSFDuet1-6xHis-TEV
-
Backbone manufacturerNovagen (+ 6xHis-TEV in-house modification)
- Backbone size w/o insert (bp) 3810
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE. coli ornithine transcarbamylase (OTC), fused to human ubiquitin
-
SpeciesH. sapiens (human); E. coli
-
Insert Size (bp)1240
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CCCTGTAGAAATAATTTTGTTTAAC
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1-His-TEV-OTC_Ub was a gift from Shang-Te Danny Hsu (Addgene plasmid # 172134 ; http://n2t.net/addgene:172134 ; RRID:Addgene_172134) -
For your References section:
Direct Visualization of a 26 kDa Protein by Cryo-Electron Microscopy Aided by a Small Scaffold Protein. Chiu YH, Ko KT, Yang TJ, Wu KP, Ho MR, Draczkowski P, Hsu SD. Biochemistry. 2021 Apr 13;60(14):1075-1079. doi: 10.1021/acs.biochem.0c00961. Epub 2021 Mar 15. 10.1021/acs.biochem.0c00961 PubMed 33719392