Skip to main content
Addgene
Open Menu

CVS-N2c-EGFP-ChIEF
(Plasmid #172371)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 172371 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 172371-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 172371-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Rabies CVS N2c(deltaG)
  • Backbone manufacturer
    Matthias J. Schnell, Thomas Jefferson University
  • Backbone size w/o insert (bp) 14070
  • Vector type
    Neurotropic virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP + ChIEF
  • Species
    Other
  • Insert Size (bp)
    1824

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGAGGTTATCCTCGGGACTGGAATCG
  • 3′ sequencing primer GCCTCTTGGATGTGAAAAAAACTATTAACATCCCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.12.23.474014 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CVS-N2c-EGFP-ChIEF was a gift from Yoav Ben-Simon & Peter Jonas (Addgene plasmid # 172371 ; http://n2t.net/addgene:172371 ; RRID:Addgene_172371)

  • For your References section:

    Fast, high-throughput production of improved rabies viral vectors for specific, efficient and versatile transsynaptic retrograde labeling. Sumser A, Joesch M, Jonas P, Ben-Simon Y. Elife. 2022 Aug 30;11:e79848. doi: 10.7554/eLife.79848. 10.7554/eLife.79848 PubMed 36040301
Related items:
Commonly requested with: