pM378
(Plasmid
#173174)
-
PurposeExpresses C9-1 gRNA-12xMBS from hU6 promoter
-
Depositing Lab
-
Depositing OrganizationUlsan National Institute of Science and Technology (UNIST)
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 173174-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 173174-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 5247
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC9-1 targeting gRNA-12xMBS
-
gRNA/shRNA sequenceTGGAATGGAATGGAATGGAA
-
SpeciesH. sapiens (human)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttcaccgagggcctatttccc
- 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 173174-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 173174-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM378 was a gift from Hajin Kim (Addgene plasmid # 173174 ; http://n2t.net/addgene:173174 ; RRID:Addgene_173174) -
For your References section:
Background-suppressed live visualization of genomic loci with an improved CRISPR system based on a split fluorophore. Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H. Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4. 10.1101/gr.260018.119 PubMed 32887690