AktPH-mCherry-T2A-PHR-T2A-CIBNcaax
(Plasmid
#173861)
-
PurposeMammalian expression of Akt PH-mCherry-T2A-PHR-T2A-CIBNcaax (PIP3 marker and opto-control)
-
Depositing Lab
-
Depositing OrganizationInstitute of Science Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 173861-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 173861-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerModified from Clontech
- Backbone size w/o insert (bp) 4588
- Total vector size (bp) 8005
-
Modifications to backboneEGFP was removed
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAktPH-mCherry-T2A-PHR-T2A-CIBNcaax
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)3417
- Promoter CAG
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- C-terminal CAAX-box (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGTTATTGTGCTGTCTCATC
- 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 173861-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 173861-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AktPH-mCherry-T2A-PHR-T2A-CIBNcaax was a gift from Takao Nakata (Addgene plasmid # 173861 ; http://n2t.net/addgene:173861 ; RRID:Addgene_173861) -
For your References section:
Optogenetic control of PIP3: PIP3 is sufficient to induce the actin-based active part of growth cones and is regulated via endocytosis. Kakumoto T, Nakata T. PLoS One. 2013 Aug 7;8(8):e70861. doi: 10.1371/journal.pone.0070861. eCollection 2013. 10.1371/journal.pone.0070861 PubMed 23951027