Skip to main content

mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
(Plasmid #173866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173866 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 173866-D50 50 μg of DNA in Tris buffer $495
DNA 173866-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3946
  • Total vector size (bp) 6736
  • Modifications to backbone
    EGFP was removed
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
  • Species
    H. sapiens (human); Avena sativa (oat)
  • Insert Size (bp)
    2793
  • GenBank ID
  • Promoter CMV
  • Tags / Fusion Proteins
    • mVenus (N terminal on insert)
    • C-terminal CAAX-box (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTGG
  • 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax was a gift from Takao Nakata (Addgene plasmid # 173866 ; http://n2t.net/addgene:173866 ; RRID:Addgene_173866)
  • For your References section:

    Optogenetic control of small GTPases reveals RhoA mediates intracellular calcium signaling. Inaba H, Miao Q, Nakata T. J Biol Chem. 2021 Jan-Jun;296:100290. doi: 10.1016/j.jbc.2021.100290. Epub 2021 Jan 13. 10.1016/j.jbc.2021.100290 PubMed 33453281