Skip to main content

pGL3-noSV40-humanEC1.45_p300peak1
(Plasmid #173947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173947 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 173947-D50 50 μg of DNA in Tris buffer $495
DNA 173947-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3-Promoter, GenBank: U47298.2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5016
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p300 peak 1 from SOX9 enhancer cluster EC1.45
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1098
  • Mutation
    None
  • Promoter SV40 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
  • 3′ sequencing primer GAGTTAGGGGCGGGATGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-noSV40-humanEC1.45_p300peak1 was a gift from Joanna Wysocka (Addgene plasmid # 173947 ; http://n2t.net/addgene:173947 ; RRID:Addgene_173947)
  • For your References section:

    Loss of Extreme Long-Range Enhancers in Human Neural Crest Drives a Craniofacial Disorder. Long HK, Osterwalder M, Welsh IC, Hansen K, Davies JOJ, Liu YE, Koska M, Adams AT, Aho R, Arora N, Ikeda K, Williams RM, Sauka-Spengler T, Porteus MH, Mohun T, Dickel DE, Swigut T, Hughes JR, Higgs DR, Visel A, Selleri L, Wysocka J. Cell Stem Cell. 2020 Nov 5;27(5):765-783.e14. doi: 10.1016/j.stem.2020.09.001. Epub 2020 Sep 28. 10.1016/j.stem.2020.09.001 PubMed 32991838