pGL3-noSV40-mouseEC1.45
(Plasmid
#173972)
-
PurposeFirefly luciferase enhancer reporter plasmid.
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 173972-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 173972-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Promoter, GenBank: U47298.2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5016
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse orthologous SOX9 enhancer cluster EC1.45
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3548
-
MutationNone
- Promoter SV40 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
- 3′ sequencing primer GAGTTAGGGGCGGGATGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 173972-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 173972-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-noSV40-mouseEC1.45 was a gift from Joanna Wysocka (Addgene plasmid # 173972 ; http://n2t.net/addgene:173972 ; RRID:Addgene_173972) -
For your References section:
Loss of Extreme Long-Range Enhancers in Human Neural Crest Drives a Craniofacial Disorder. Long HK, Osterwalder M, Welsh IC, Hansen K, Davies JOJ, Liu YE, Koska M, Adams AT, Aho R, Arora N, Ikeda K, Williams RM, Sauka-Spengler T, Porteus MH, Mohun T, Dickel DE, Swigut T, Hughes JR, Higgs DR, Visel A, Selleri L, Wysocka J. Cell Stem Cell. 2020 Nov 5;27(5):765-783.e14. doi: 10.1016/j.stem.2020.09.001. Epub 2020 Sep 28. 10.1016/j.stem.2020.09.001 PubMed 32991838