pCm N-term SMT3 NikJC199U
(Plasmid
#174210)
-
PurposeExpression plasmid with a TEV removable C-term 8xHis Tag, an N-term SUMO tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Santa Barbara
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCm N-term-SMT3
- Backbone size w/o insert (bp) 3822
- Total vector size (bp) 5184
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
-
SpeciesStreptomyces tendae
-
Insert Size (bp)1362
-
MutationC199U
-
GenBank IDCAC80908.1
- Promoter T7
-
Tags
/ Fusion Proteins
- SMT3 (N terminal on backbone)
- 8xHis (C terminal on backbone)
- TEV (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatataccatgagcactagtgactcagaagtcaatcaag
- 3′ sequencing primer gtttccctgTGCCGGACGCAGGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNikJ gene was a gift from Dr. Kenichi Yokoyama, Department of biochemistry, Duke University medical Center, Durham, north Carolina, USA. Department of Chemistry, Duke University, Durham, north Carolina, USA. *e-mail: [email protected]
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCm N-term SMT3 NikJC199U was a gift from Brandon Greene (Addgene plasmid # 174210 ; http://n2t.net/addgene:174210 ; RRID:Addgene_174210) -
For your References section:
Selenocysteine substitutions in thiyl radical enzymes. Caceres JC, Bailey CA, Yokoyama K, Greene BL. Methods Enzymol. 2022;662:119-141. doi: 10.1016/bs.mie.2021.10.014. Epub 2021 Dec 7. 10.1016/bs.mie.2021.10.014 PubMed 35101207