iBE3 CLYBL
(Plasmid
#174569)
-
Purposedoxycycline inducible BE3 expression for human CLYBL locus knock-in
-
Depositing Lab
-
Depositing OrganizationWellcome Sanger Institute
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 174569-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 174569-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAddgene plasmid #124229
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin ; mApple
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBE3
-
SpeciesSynthetic
- Promoter tet ON
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesised gene fragment insert using this paper as a reference https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-018-0617-1. The backbone was from this Addgene plasmid #124229.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.29.486051 for bioRxiv preprint.
DNA (Catalog # 174569-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 174569-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iBE3 CLYBL was a gift from Mathew Garnett (Addgene plasmid # 174569 ; http://n2t.net/addgene:174569 ; RRID:Addgene_174569) -
For your References section:
Base editing screens map mutations affecting interferon-gamma signaling in cancer. Coelho MA, Cooper S, Strauss ME, Karakoc E, Bhosle S, Goncalves E, Picco G, Burgold T, Cattaneo CM, Veninga V, Consonni S, Dincer C, Vieira SF, Gibson F, Barthorpe S, Hardy C, Rein J, Thomas M, Marioni J, Voest EE, Bassett A, Garnett MJ. Cancer Cell. 2023 Feb 13;41(2):288-303.e6. doi: 10.1016/j.ccell.2022.12.009. Epub 2023 Jan 19. 10.1016/j.ccell.2022.12.009 PubMed 36669486
