FLAG-Foxo1-ADA 6KQ
(Plasmid #17563)

• Depositing Lab: Domenico Accili
• Depositing Organization: Columbia University
  Located in the United States of America
• Publication: Kitamura et al Cell Metab. 2005 Sep . 2(3):153-63.

Backbone

• Vector backbone: pCMV5
• Backbone size w/o insert (bp): 5600
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Foxo1 ADA 6KQ
• Alt name: Foxo1
• Alt name: Fkhr
• Alt name: forkhead box O1
• Species: M. musculus (mouse)
• Insert Size (bp): 1700
• Mutation: K242, K245, K259, K262, K271 and K291 were replaced with glutamine.It also contains T24A, S253D and S316A mutations.
• GenBank ID: NM_019739
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Myc (C terminal on backbone)
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMV-F; pCEP-F
• 3′ sequencing primer: hGH-pA-R (CCAGCTTGGTTCCCAATAGA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has an E15G mutation that is not thought to affect plasmid function. It also has K219R, G282R, and L619P polymorphisms.

DNA (Catalog # 17563-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 17563-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.