Skip to main content

pX459-dCTNNA1
(Plasmid #176032)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176032 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 176032-D50 50 μg of DNA in Tris buffer $495
DNA 176032-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX459
  • Backbone manufacturer
    https://www.addgene.org/48139/
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    A gRNA targeting the dog CTNNA1 (alpha-1-catenin) gene and the cDNA of Cas9
  • gRNA/shRNA sequence
    GTAGAAGATGTTCGAAAACA
  • Insert Size (bp)
    5000
  • Entrez Gene
    CTNNA1

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-dCTNNA1 was a gift from Michiyuki Matsuda (Addgene plasmid # 176032 ; http://n2t.net/addgene:176032 ; RRID:Addgene_176032)
  • For your References section:

    A feedback loop between lamellipodial extension and HGF-ERK signaling specifies leader cells during collective cell migration. Hino N, Matsuda K, Jikko Y, Maryu G, Sakai K, Imamura R, Tsukiji S, Aoki K, Terai K, Hirashima T, Trepat X, Matsuda M. Dev Cell. 2022 Oct 10;57(19):2290-2304.e7. doi: 10.1016/j.devcel.2022.09.003. Epub 2022 Sep 28. 10.1016/j.devcel.2022.09.003 PubMed 36174555