Skip to main content

pNOC_hfnCas12a-Nlux_crRNA NR1
(Plasmid #176244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176244 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 176244-D50 50 μg of DNA in Tris buffer $495
DNA 176244-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR, Luciferase, Synthetic Biology ; Expression in microalgae Nannochloropsis oceanica
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized fnCas12a
  • Species
    Francisella novicida
  • Promoter Ribosomal subunit
  • Tag / Fusion Protein
    • luciferase (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTACTCGTCTCTCTTGG
  • 3′ sequencing primer TCCTGGCCTTTCTTAGCATCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of plasmid was a gift from Eva Farre from Michigan State University. And the Cas12a sequence was obtained from the Addgene plasmid # 69976

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNOC_hfnCas12a-Nlux_crRNA NR1 was a gift from John van der Oost (Addgene plasmid # 176244 ; http://n2t.net/addgene:176244 ; RRID:Addgene_176244)
  • For your References section:

    Comprehensive Genome Engineering Toolbox for Microalgae Nannochloropsis oceanica Based on CRISPR-Cas Systems. Naduthodi MIS, Sudfeld C, Avitzigiannis EK, Trevisan N, van Lith E, Alcaide Sancho J, D'Adamo S, Barbosa M, van der Oost J. ACS Synth Biol. 2021 Dec 17;10(12):3369-3378. doi: 10.1021/acssynbio.1c00329. Epub 2021 Nov 18. 10.1021/acssynbio.1c00329 PubMed 34793143