pCDNA3-myc-his-BACH1 P47A
(Plasmid
#17644)
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 17644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 17644-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 17644-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(+)/myc-His A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5493
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBACH1
-
Alt nameBRIP1
-
Alt nameFANCJ
-
SpeciesH. sapiens (human)
-
MutationTo generate the tumor-associated mutant, the proline at position 47 was changed to an alanine by Quikchange site-directed mutagenesis (Stratagene) using the following primers: [CATTGTTTGTTGGAGAGTGCCACAGGAAGTGGAAAAGC] and [GCTTTTTCCACTTCCTGTGGCACTCTCCAACAAACAATG]
-
GenBank IDAF360549
-
Entrez GeneBRIP1 (a.k.a. BACH1, FANCJ, OF)
-
Tags
/ Fusion Proteins
- Myc (C terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Apa1 (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 17644-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 17644-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3-myc-his-BACH1 P47A was a gift from Ronny Drapkin (Addgene plasmid # 17644 ; http://n2t.net/addgene:17644 ; RRID:Addgene_17644) -
For your References section:
The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Cantor S, Drapkin R, Zhang F, Lin Y, Han J, Pamidi S, Livingston DM. Proc Natl Acad Sci U S A. 2004 Feb 24. 101(8):2357-62. 10.1073/pnas.0308717101 PubMed 14983014