pCDNA3-myc-his-BACH1 P47A
(Plasmid
#17644)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 17644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1(+)/myc-His A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5493
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBACH1
-
Alt nameBRIP1
-
Alt nameFANCJ
-
SpeciesH. sapiens (human)
-
MutationTo generate the tumor-associated mutant, the proline at position 47 was changed to an alanine by Quikchange site-directed mutagenesis (Stratagene) using the following primers: [CATTGTTTGTTGGAGAGTGCCACAGGAAGTGGAAAAGC] and [GCTTTTTCCACTTCCTGTGGCACTCTCCAACAAACAATG]
-
GenBank IDAF360549
-
Entrez GeneBRIP1 (a.k.a. BACH1, FANCJ, OF)
-
Tags
/ Fusion Proteins
- Myc (C terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Apa1 (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer SP6
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3-myc-his-BACH1 P47A was a gift from Ronny Drapkin (Addgene plasmid # 17644 ; http://n2t.net/addgene:17644 ; RRID:Addgene_17644) -
For your References section:
The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Cantor S, Drapkin R, Zhang F, Lin Y, Han J, Pamidi S, Livingston DM. Proc Natl Acad Sci U S A. 2004 Feb 24. 101(8):2357-62. 10.1073/pnas.0308717101 PubMed 14983014