pYTRW18K_3T5
(Plasmid
#177288)
-
Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcR and mCherry
-
Depositing Lab
-
Depositing OrganizationHeinrich-Heine-Universitaet Duesseldorf
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYTRW09K_0T5
- Backbone size w/o insert (bp) 10451
-
Vector typeBacterial Expression, Synthetic Biology ; Yeast Expression, Tn5 genomic integration
-
Selectable markersURA3 ; Tetracycline
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Alt namepromotorless mCherry
-
Alt nameRed fluorescent protein
-
SpeciesDiscosoma sp.
-
Insert Size (bp)740
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCAATCTCGCGCTATTGTG
- 3′ sequencing primer CCATGGACGCGTAGTCGTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJaeger Lab (from pAra-mCherry)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the pYT vector series which facilitates chromosomal integration via Tn5 tranposition with selection on tetracycline and transcriptional reporter mCherry (https://www.fpbase.org/protein/mcherry/; methods: flow cytometry, fluorescence visualisation, fluorescence measurements). Target genes can be inserted at the I-SceI site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTRW18K_3T5 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177288 ; http://n2t.net/addgene:177288 ; RRID:Addgene_177288) -
For your References section:
The modular pYT vector series employed for chromosomal gene integration and expression to produce carbazoles and glycolipids in P. putida. Weihmann R, Kubicki S, Bitzenhofer NL, Domrose A, Bator I, Kirschen LM, Kofler F, Funk A, Tiso T, Blank LM, Jaeger KE, Drepper T, Thies S, Loeschcke A. FEMS Microbes. 2022 Dec 19;4:xtac030. doi: 10.1093/femsmc/xtac030. eCollection 2023. 10.1093/femsmc/xtac030 PubMed 37333445