pYTSK01K_0G7
(Plasmid
#177296)
-
Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneyTREX backbone
- Backbone size w/o insert (bp) 14684
-
Vector typeBacterial Expression, Synthetic Biology ; Yeast Expression, Tn7 genomic integration
-
Selectable markersGentamicin ; URA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePaacC1-aacC1
-
Alt namegentamicin resistance module - GmR
-
Alt nameGentamicin 3-N-acetyltransferase
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)752
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TACGACTACGCGTCCATGGC
- 3′ sequencing primer GCCAAATTGCGTCAAGATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKyoung-Hee Choi et al (pUC18-mini-GM in PMID: 15908923)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the pYT vector series which facilitates chromosomal integration in attTn7-site with selection on gentamicin. Target expression cassettes can be inserted at the I-SceI site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTSK01K_0G7 was a gift from Karl-Erich Jaeger (Addgene plasmid # 177296 ; http://n2t.net/addgene:177296 ; RRID:Addgene_177296) -
For your References section:
Integration of Genetic and Process Engineering for Optimized Rhamnolipid Production Using Pseudomonas putida. Tiso T, Ihling N, Kubicki S, Biselli A, Schonhoff A, Bator I, Thies S, Karmainski T, Kruth S, Willenbrink AL, Loeschcke A, Zapp P, Jupke A, Jaeger KE, Buchs J, Blank LM. Front Bioeng Biotechnol. 2020 Aug 20;8:976. doi: 10.3389/fbioe.2020.00976. eCollection 2020. 10.3389/fbioe.2020.00976 PubMed 32974309