AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
(Plasmid
#177360)
-
PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepX602-AAV-TBG__NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6__BsaI-sgRNA
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6189
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Insert Size (bp)3320
- Promoter Synapsine promoter
-
Tags
/ Fusion Proteins
- P2A (C terminal on insert)
- a tetracycline-controlled transactivator (tTA) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer AGATGGTCGCGCCCGTGCCCCCCTAT
- 3′ sequencing primer ACGTGAAGCACCCCGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChimeric guide for SaCas9
-
SpeciesStaphylococcus aureus
-
Insert Size (bp)101
- Promoter U6 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ACGTGAAGCACCCCGC
- 3′ sequencing primer cctatttcccatgattccttcat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1065603/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA was a gift from Naoki Yamamoto (Addgene plasmid # 177360 ; http://n2t.net/addgene:177360 ; RRID:Addgene_177360) -
For your References section:
Engineering of AAV-Mediated in Vivo Targeted DNA Methylation Editing System via Staphylococcus Aureus Derived Cas9-SunTag. Yamamoto N, Morita S, Hatada I, Ideta-Otsuka M, Tamura H, Narita M, Igarashi K. Research Square [Preprint] 2021. doi: 10.21203/rs.3.rs-1065603/v1. 10.21203/rs.3.rs-1065603/v1