ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
(Plasmid
#178096)
-
PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 3005
-
Vector typeMammalian Expression, CRISPR ; Prime editing
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G3 + MTOR nick exon-44 sgRNAs
-
SpeciesH. sapiens (human)
- Promoter Tandem U6 promoters
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer TGAGCGAGGAAGCGGAAGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 178096 ; http://n2t.net/addgene:178096 ; RRID:Addgene_178096) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338