pFUW-TetO-Txnip
(Plasmid
#178437)
-
Purposedoxycycline-inducible expression of Mouse Txnip in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFUW-TetO
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTxnip
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1193
-
Entrez GeneTxnip (a.k.a. 1200008J08Rik, Hyplip1, THIF, Tbp-2, VDUP1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer TCCACGCTGTTTTGACCTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a M172K mutation in mouse Txnip compared to the NCBI reference sequence NP_001009935.1. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-TetO-Txnip was a gift from Filipe Pereira (Addgene plasmid # 178437 ; http://n2t.net/addgene:178437 ; RRID:Addgene_178437) -
For your References section:
Single-cell transcriptional profiling informs efficient reprogramming of human somatic cells to cross-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Halitzki E, Zahan T, Arh N, Zimmermannova O, Ferreira AG, Li H, Karlsson S, Scheding S, Pereira CF. Sci Immunol. 2022 Mar 4;7(69):eabg5539. doi: 10.1126/sciimmunol.abg5539. Epub 2022 Mar 4. 10.1126/sciimmunol.abg5539 PubMed 35245086