pCAG-hPPP3R1
(Plasmid
#179136)
-
PurposeExpression vector of human protein phosphatase 3, regulatory subunit B, alpha isoform (PPP3R1), CAG promoter, rabbit globin poly(A) signal.
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5142
- Total vector size (bp) 5661
-
Modifications to backbonepCAGGS was used as an original vector.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprotein phosphatase 3, regulatory subunit B, alpha isoform
-
Alt namePPP3R1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)519
-
Entrez GenePPP3R1 (a.k.a. CALNB1, CNB, CNB1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-hPPP3R1 was a gift from Masahito Ikawa (Addgene plasmid # 179136 ; http://n2t.net/addgene:179136 ; RRID:Addgene_179136) -
For your References section:
SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice. Miyata H, Oura S, Morohoshi A, Shimada K, Mashiko D, Oyama Y, Kaneda Y, Matsumura T, Abbasi F, Ikawa M. Proc Natl Acad Sci U S A. 2021 Aug 31;118(35). pii: 2106673118. doi: 10.1073/pnas.2106673118. 10.1073/pnas.2106673118 PubMed 34446558