HIS_TEV_hsSYX3
(Plasmid
#179290)
-
PurposeE. coli expression plasmid (T7lac promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + TEV protease cleavage site
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5236
- Total vector size (bp) 6499
-
Modifications to backbonenone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSyx
-
Alt namesynectin-binding guanine exchange factor
-
Alt namepleckstrin homology domain-containing family G member 5 isoform c
-
Alt namePLEKHG5; CMTRIC; DSMA4; GEF720; Tech
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Mutationresidues 393-792 from accession number NP_001036128.1; optimized DNA sequence
-
GenBank IDNP_001036128.1
- Promoter T7lac
-
Tag
/ Fusion Protein
- His6 + TEV protease cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7, TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 Terminal, GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence is MGSS + HHHHHH + GGG + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + human Syx (synectin-binding guanine exchange factor; aa 393-792 from accession number NP_001036128.1).
Confers kanamycin-resistance.
Backbone vector is pET-28a.
Construct design by Ryan Boyd.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HIS_TEV_hsSYX3 was a gift from Debra Hansen (Addgene plasmid # 179290 ; http://n2t.net/addgene:179290 ; RRID:Addgene_179290) -
For your References section:
Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma. Boyd RJ, Olson TL, Zook JD, Stein D, Aceves M, Lin WH, Craciunescu FM, Hansen DT, Anastasiadis PZ, Singharoy A, Fromme P. FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR. 10.1096/fj.202101808RR PubMed 35639414