AAVS1-PuroR Xlone eGFP
(Plasmid #179837)

• Purpose: Doxycycline-inducible expression of eGFP
• Depositing Lab: Xiaoping Bao
• Publication: Jung et al ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017.

Backbone

• Vector backbone: Addgene #136936
• Backbone size w/o insert (bp): 9657
• Total vector size (bp): 10374
• Vector type: Mammalian Expression, CRISPR, TALEN, Synthetic Biology ; Donor plasmid
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: TRE3GS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gcgcctataaaagagtgctga
• 3′ sequencing primer: cgcctgtcttaggttggagt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid is identical to Addgene plasmid # 136936 except it does not contain the WPRE sequence.