AAVS1-PuroR Xlone eGFP
(Plasmid
#179837)
-
PurposeDoxycycline-inducible expression of eGFP
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 179837-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 179837-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAddgene #136936
- Backbone size w/o insert (bp) 9657
- Total vector size (bp) 10374
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology ; Donor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter TRE3GS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer cgcctgtcttaggttggagt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid is identical to Addgene plasmid # 136936 except it does not contain the WPRE sequence.
DNA (Catalog # 179837-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 179837-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-PuroR Xlone eGFP was a gift from Xiaoping Bao (Addgene plasmid # 179837 ; http://n2t.net/addgene:179837 ; RRID:Addgene_179837) -
For your References section:
Temporal Expression of Transcription Factor ID2 Improves Natural Killer Cell Differentiation from Human Pluripotent Stem Cells. Jung J, Chang Y, Jin G, Lian X, Bao X. ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017. 10.1021/acssynbio.2c00017 PubMed 35608547
Map uploaded by the depositor.
