pRB144
(Plasmid
#180175)
-
PurposepCDNA3.1 Construct GluN1 A714L
-
Depositing Lab
-
Depositing OrganizationUniversity of Ottawa
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 180175-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 180175-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerAddgene #82612
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGluN1
-
Alt nameGriN1/ NMDAR1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3549
-
MutationA714L
-
Entrez GeneGrin1 (a.k.a. GluN1, NMDAR1, NR1)
-
Tag
/ Fusion Protein
- Phluorin (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
- 3′ sequencing primer GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 180175-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 180175-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB144 was a gift from Richard Bergeron (Addgene plasmid # 180175 ; http://n2t.net/addgene:180175 ; RRID:Addgene_180175) -
For your References section:
Glycine-induced NMDA receptor internalization provides neuroprotection and preserves vasculature following ischemic stroke. Cappelli J, Khacho P, Wang B, Sokolovski A, Bakkar W, Raymond S, Ahlskog N, Pitney J, Wu J, Chudalayandi P, Wong AYC, Bergeron R. iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21. 10.1016/j.isci.2021.103539 PubMed 34977503
Map uploaded by the depositor.
