pAAV-MCU-EGFP
(Plasmid
#181866)
-
PurposeExpresses GFP-tagged mitochondrial calcium uniporter (MCU) under control of the CaMKIIa promoter
-
Depositing Lab
-
Depositing OrganizationUniversitaet Heidelberg
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CaMKIIa
-
Vector typeMammalian Expression, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemitochondrial calcium uniporter
-
Alt nameMCU
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1059
-
GenBank IDNM_001033259.4
-
Entrez GeneMcu (a.k.a. 2010012O16Rik, C10orf42, Ccdc109a, D130073L02Rik, Gm64)
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TGGGGACCTGGATGCTGACGAA
- 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOrigene, MC212635
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-MCU-EGFP was a gift from Hilmar Bading (Addgene plasmid # 181866 ; http://n2t.net/addgene:181866 ; RRID:Addgene_181866) -
For your References section:
Mitochondrial calcium uniporter Mcu controls excitotoxicity and is transcriptionally repressed by neuroprotective nuclear calcium signals. Qiu J, Tan YW, Hagenston AM, Martel MA, Kneisel N, Skehel PA, Wyllie DJ, Bading H, Hardingham GE. Nat Commun. 2013;4:2034. doi: 10.1038/ncomms3034. 10.1038/ncomms3034 PubMed 23774321