Skip to main content

pTol2-eab2-GA
(Plasmid #182156)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182156 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 182156-D50 50 μg of DNA in Tris buffer $495
DNA 182156-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTol2-eab2
  • Backbone size w/o insert (bp) 6567
  • Total vector size (bp) 7895
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GA
  • Alt name
    N-eGFP-intron-C-mApple
  • Species
    Synthetic
  • Insert Size (bp)
    1328
  • Promoter eab2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer GCAGAGCAAAACAGGAAGTTGACTC
  • 3′ sequencing primer GCATCACAAATTTCACAAATAAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-eab2-GA was a gift from Hui Zong (Addgene plasmid # 182156 ; http://n2t.net/addgene:182156 ; RRID:Addgene_182156)
  • For your References section:

    zMADM (zebrafish mosaic analysis with double markers) for single-cell gene knockout and dual-lineage tracing. Xu B, Kucenas S, Zong H. Proc Natl Acad Sci U S A. 2022 Mar 1;119(9). pii: 2122529119. doi: 10.1073/pnas.2122529119. 10.1073/pnas.2122529119 PubMed 35197298