pGAL1-VP1 (LEU2)
(Plasmid
#182480)
-
PurposeYeast integrative plasmid for expressing deltaVP1, an NLS deletion mutant of Murine polyomavirus VP1 (GAL1 promoter). Contains leucine auxotrophic marker (K. lactis LEU2).
-
Depositing Lab
-
Depositing OrganizationUniversity of Queensland
Located in Australia -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUG73
-
Vector typeYeast Expression, Synthetic Biology ; Metabolic engineering
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeltaVP1
-
Alt namedeltaNLS VP1
-
SpeciesSynthetic; Murine polyomavirus
-
Insert Size (bp)1143
- Promoter GAL1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTCTTATTCAAATGTCATAAAAGTATCAAC
- 3′ sequencing primer CCAGCCTGCTTTTCTGTAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAL1-VP1 (LEU2) was a gift from Claudia Vickers (Addgene plasmid # 182480 ; http://n2t.net/addgene:182480 ; RRID:Addgene_182480) -
For your References section:
Synthetic in vivo compartmentalisation improves metabolic flux and modulates the product profile of promiscuous enzymes. Cheah LC, Liu L, Plan MR, Peng B, Lu Z, Schenk G, Vickers CE, Sainsbury F. bioRxiv 2022.11.24.517869 10.1101/2022.11.24.517869