pLY185
(Plasmid
#184146)
-
PurposeRFP generator controlled by Plux2 promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Edinburgh
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184146-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184146-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonep15AC
-
Backbone manufacturerp15A vector from pdCas9-bacteria (Plasmid #44249)
- Backbone size w/o insert (bp) 1725
- Total vector size (bp) 3593
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCulture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namerfp
-
SpeciesSynthetic
-
Insert Size (bp)1847
- Promoter Plux2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer AACGGTCTGGTTATAGGTACATTGAGCAAC
- 3′ sequencing primer GTTCGTAAGCCATTTCCGCTCGCCGCAGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 184146-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184146-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLY185 was a gift from Baojun Wang (Addgene plasmid # 184146 ; http://n2t.net/addgene:184146 ; RRID:Addgene_184146) -
For your References section:
Reprogrammed tracrRNAs enable repurposing of RNAs as crRNAs and sequence-specific RNA biosensors. Liu Y, Pinto F, Wan X, Yang Z, Peng S, Li M, Cooper JM, Xie Z, French CE, Wang B. Nat Commun. 2022 Apr 11;13(1):1937. doi: 10.1038/s41467-022-29604-x. 10.1038/s41467-022-29604-x PubMed 35410423
Map uploaded by the depositor.
