pCMV10-3xFLAG-prs-MCP1
(Plasmid
#184341)
-
PurposeExpress yeast MCP1 in Expi293F cells
-
Depositing Lab
-
Depositing OrganizationYale University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184341-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184341-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV10
- Backbone size w/o insert (bp) 6281
- Total vector size (bp) 7190
-
Modifications to backboneDigested with NotI and BamHI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYeast MCP1
-
Alt nameMDM10 complementing protein 1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)909
-
GenBank IDNC_001147.6 YOR228C
-
Entrez GeneMCP1 (a.k.a. YOR228C)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG-PreScission cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggggccccttgcggccgccATGATAAAGTTGCATGAAGTGCC
- 3′ sequencing primer agggatgccacccgggatccctaattcacgtgcaacagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 184341-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184341-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV10-3xFLAG-prs-MCP1 was a gift from Karin Reinisch (Addgene plasmid # 184341 ; http://n2t.net/addgene:184341 ; RRID:Addgene_184341) -
For your References section:
Structural and biochemical insights into lipid transport by VPS13 proteins. Adlakha J, Hong Z, Li P, Reinisch KM. J Cell Biol. 2022 Jun 6;221(5):e202202030. doi: 10.1083/jcb.202202030. Epub 2022 Mar 31. 10.1083/jcb.202202030 PubMed 35357422
Map uploaded by the depositor.
