pVITRO1-BFP-NLS
(Plasmid
#184458)
-
PurposeNucleus-targeted EBFP2 expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184458-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184458-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepVITRO1-hygro-mcs
-
Backbone manufacturerInvivoGen
- Backbone size w/o insert (bp) 6491
- Total vector size (bp) 6757
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEBFP2-3xNLS
-
SpeciesSynthetic
-
Insert Size (bp)266
-
MutationWT
- Promoter Rat EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer GGAAAGACCAGGCGGAGTTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 184458-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184458-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVITRO1-BFP-NLS was a gift from Chuan-Hsiang Huang (Addgene plasmid # 184458 ; http://n2t.net/addgene:184458 ; RRID:Addgene_184458) -
For your References section:
Deciphering cell signaling networks with massively multiplexed biosensor barcoding. Yang JM, Chi WY, Liang J, Takayanagi S, Iglesias PA, Huang CH. Cell. 2021 Dec 9;184(25):6193-6206.e14. doi: 10.1016/j.cell.2021.11.005. Epub 2021 Nov 26. 10.1016/j.cell.2021.11.005 PubMed 34838160