Skip to main content

pPbuCas13b
(Plasmid #184565)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184565 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD33
  • Backbone size w/o insert (bp) 4041
  • Total vector size (bp) 7425
  • Modifications to backbone
    Arabinose cassette exchanged with insert
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas13b nuclease from Prevotella buccae
  • Alt name
    PbuCas13b
  • Species
    Prevotella buccae
  • Insert Size (bp)
    3384
  • GenBank ID
    WP_004343973.1
  • Promoter T7 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atcttccccatcggtgatgtc
  • 3′ sequencing primer acggcgtttcacttctgagt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid #89906.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPbuCas13b was a gift from Chase Beisel (Addgene plasmid # 184565 ; http://n2t.net/addgene:184565 ; RRID:Addgene_184565)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413