pAcrVIB1
(Plasmid
#184566)
-
PurposeInducible expression of anti-CRISPR protein AcrVIB1 in bacteria.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET24(+)
-
Backbone manufacturerTwist Bioscience
- Backbone size w/o insert (bp) 5272
- Total vector size (bp) 5620
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-CRISPR protein inhibiting Cas13b nucleases
-
Alt nameAcrVIB1
-
SpeciesRiemerella anatipestifer
-
Insert Size (bp)348
-
GenBank IDWP_004917816.1
- Promoter T7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer atcttccccatcggtgatgtc
- 3′ sequencing primer gcccactacgtgaaccatca
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcrVIB1 was a gift from Chase Beisel (Addgene plasmid # 184566 ; http://n2t.net/addgene:184566 ; RRID:Addgene_184566) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413