Skip to main content

nuc-GafD-mTurboID-HA
(Plasmid #184641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184641 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 184641-D50 50 μg of DNA in Tris buffer $495
DNA 184641-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 6809
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuc-GlycoID-HA
  • Alt name
    nucleus targeted GafD (22-178)--miniTurboID (BirA*), HA-tagged
  • Species
    Escherichia coli
  • Insert Size (bp)
    1440
  • Mutation
    GafD -> expressed 22-178 ; BirA* -> expressed the miniTurboID variant (Alice Ting Lab)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Nuclear localization sequence (C terminal on insert)
    • 3xHA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer TurboID reverse: TGTTTATCAATCCCCCGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nuc-GafD-mTurboID-HA was a gift from Charlie Fehl (Addgene plasmid # 184641 ; http://n2t.net/addgene:184641 ; RRID:Addgene_184641)
  • For your References section:

    Spatiotemporal Proximity Labeling Tools to Track GlcNAc Sugar-Modified Functional Protein Hubs during Cellular Signaling. Liu Y, Nelson ZM, Reda A, Fehl C. ACS Chem Biol. 2022 Jul 12. doi: 10.1021/acschembio.2c00282. 10.1021/acschembio.2c00282 PubMed 35819414