pSCL.180
(Plasmid
#185001)
-
PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNA
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185001-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185001-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepFUGW-H1 (Addgene plasmid #25870)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
-
gRNA/shRNA sequencegtcccctccaccccacagtg
-
SpeciesE. coli
-
MutationAAVS1 donor, a1/a2 length extended for 27 bp
- Promoter H1
-
Tags
/ Fusion Proteins
- SV40NLS (N terminal on insert)
- SV40NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 185001-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185001-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL.180 was a gift from Seth Shipman (Addgene plasmid # 185001 ; http://n2t.net/addgene:185001 ; RRID:Addgene_185001) -
For your References section:
Precise genome editing across kingdoms of life using retron-derived DNA. Lopez SC, Crawford KD, Lear SK, Bhattarai-Kline S, Shipman SL. Nat Chem Biol. 2022 Feb;18(2):199-206. doi: 10.1038/s41589-021-00927-y. Epub 2021 Dec 23. 10.1038/s41589-021-00927-y PubMed 34949838