Skip to main content

pJET-CMV-GFP-P2A-I15-P2A-mCherry
(Plasmid #185620)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185620 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 185620-D50 50 μg of DNA in Tris buffer $495
DNA 185620-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pJET1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6177
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-I15-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3100
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgactcactatagggagagcggc
  • 3′ sequencing primer aagaacatcgattttccatggcag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Based on: Addgene #105686

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-CMV-GFP-P2A-I15-P2A-mCherry was a gift from Sabine Fuchs (Addgene plasmid # 185620 ; http://n2t.net/addgene:185620 ; RRID:Addgene_185620)
  • For your References section:

    Isoleucine-to-valine substitutions support cellular physiology during isoleucine deprivation. Kok G, Schene IF, Ilcken EF, Alcaraz PS, Mendes MI, Smith DEC, Salomons G, Shehata S, Jans JJM, Maroofian R, Hoek TA, van Es RM, Rehmann H, Nieuwenhuis EES, Vos HR, Fuchs SA. Nucleic Acids Res. 2025 Jan 7;53(1):gkae1184. doi: 10.1093/nar/gkae1184. 10.1093/nar/gkae1184 PubMed 39657787