pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
(Plasmid
#185676)
-
PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 185676-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 185676-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERN1 gRNA
-
Alt nameIRE1alpha
-
Alt nameIRE1a
-
gRNA/shRNA sequenceCTGGGGCCACCAGAACAGAG
-
SpeciesH. sapiens (human)
-
Entrez GeneERN1 (a.k.a. IRE1, IRE1P, IRE1a, hIRE1p)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 185676-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185676-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm was a gift from Peter Walter (Addgene plasmid # 185676 ; http://n2t.net/addgene:185676 ; RRID:Addgene_185676) -
For your References section:
Endoplasmic reticulum stress activates human IRE1alpha through reversible assembly of inactive dimers into small oligomers. Belyy V, Zuazo-Gaztelu I, Alamban A, Ashkenazi A, Walter P. Elife. 2022 Jun 22;11:e74342. doi: 10.7554/eLife.74342. 10.7554/eLife.74342 PubMed 35730415