LentiCRISPR-V2_mMSH2
(Plasmid
#186156)
-
PurposesgRNA targeting murine Msh2 gene
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186156-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186156-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneLentiCRISPR V2
- Backbone size w/o insert (bp) 12992
- Total vector size (bp) 13012
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMsh2_gRNA
-
gRNA/shRNA sequenceGGTTAATACCCTGATACAGT
-
SpeciesM. musculus (mouse)
-
Entrez GeneMsh2
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgattcc
- 3′ sequencing primer N/A
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186156-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186156-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR-V2_mMSH2 was a gift from David McFadden (Addgene plasmid # 186156 ; http://n2t.net/addgene:186156 ; RRID:Addgene_186156) -
For your References section:
Engineering Forward Genetics into Cultured Cancer Cells for Chemical Target Identification. Povedano JM, Liou J, Wei D, Srivatsav A, Kim J, Xie Y, Nijhawan D, McFadden DG. Cell Chem Biol. 2019 Sep 19;26(9):1315-1321.e3. doi: 10.1016/j.chembiol.2019.06.006. Epub 2019 Jul 11. 10.1016/j.chembiol.2019.06.006 PubMed 31303577