pDEST-Spe4-RfA
(Plasmid
#186375)
-
Purpose(Empty Backbone) Destination vector for the expression of a protein of interest into embryos, by mRNA microinjection
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 5237, Centre de Recherche en Biologie cellulaire de Montpellier
Located in France -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDEST-Spe3-RfA
-
Backbone manufacturerPMID: 17878951
- Backbone size (bp) 4888
-
Vector typeGateway Cloning
-
Selectable markersccdB gene
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-Spe4-RfA was a gift from Patrick Lemaire (Addgene plasmid # 186375 ; http://n2t.net/addgene:186375 ; RRID:Addgene_186375)