pmCherry-N1-Cofilin-S41E
(Plasmid #186751)

• Purpose: Expresses S41E phosphomimetic mCherry-tagged human cofilin in mammalian cells
• Depositing Lab: Geert van den Bogaart
• Publication: Warner et al Cell Rep. 2024 Feb 27;43(3):113866. doi: 10.1016/j.celrep.2024.113866.

Backbone

• Vector backbone: pmCherry-N1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cofilin-1
• Alt name: p18
• Alt name: CFL1
• Species: H. sapiens (human)
• Mutation: Changed serine 41 to glutamic acid
• GenBank ID: NM_005507.2
• Entrez Gene: CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: CACCTTGAAGCGCATGAACT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthetic gene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry