Skip to main content
Addgene
Open Menu

pmCherry-N1-Cofilin-S41E
(Plasmid #186751)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186751 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 186751-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 186751-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pmCherry-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cofilin-1
  • Alt name
    p18
  • Alt name
    CFL1
  • Species
    H. sapiens (human)
  • Mutation
    Changed serine 41 to glutamic acid
  • GenBank ID
    NM_005507.2
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-N1-Cofilin-S41E was a gift from Geert van den Bogaart (Addgene plasmid # 186751 ; http://n2t.net/addgene:186751 ; RRID:Addgene_186751)

  • For your References section:

    Atypical cofilin signaling drives dendritic cell migration through the extracellular matrix via nuclear deformation. Warner H, Franciosa G, van der Borg G, Coenen B, Faas F, Koenig C, de Boer R, Classens R, Maassen S, Baranov MV, Mahajan S, Dabral D, Bianchi F, van Hilten N, Risselada HJ, Roos WH, Olsen JV, Cano LQ, van den Bogaart G. Cell Rep. 2024 Feb 27;43(3):113866. doi: 10.1016/j.celrep.2024.113866. 10.1016/j.celrep.2024.113866 PubMed 38416638
Related items:
Commonly requested with: