pGL3-Camk2b
(Plasmid
#186819)
-
PurposeFluorescent reporter for Camk2b expression
-
Depositing Lab
-
Depositing OrganizationCenter for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186819-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186819-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5892
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCamk2b promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1089
-
Entrez GeneCamk2b (a.k.a. CaMKII)
- Promoter Camk2b promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CTTACGCGTATCCAGAAGATCGCCGAACAG
- 3′ sequencing primer GCGAGATCTGCTCGCTCTGTCCCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186819-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186819-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Camk2b was a gift from Hung-Chun Chang (Addgene plasmid # 186819 ; http://n2t.net/addgene:186819 ; RRID:Addgene_186819) -
For your References section:
ISX-9 potentiates CaMKIIdelta-mediated BMAL1 activation to enhance circadian amplitude. Li H, Ou J, Li Y, Xu N, Li Q, Wu P, Peng C, Tang YC, Chang HC. Commun Biol. 2022 Jul 28;5(1):750. doi: 10.1038/s42003-022-03725-x. 10.1038/s42003-022-03725-x PubMed 35902736