px459-H3f3b KO sgRNA
(Plasmid
#186941)
-
PurposeH3f3b KO in mouse ES cells
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186941-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186941-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepx459
- Backbone size w/o insert (bp) 9174
- Total vector size (bp) 9194
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH3f3b KO sgRNA
-
gRNA/shRNA sequenceTCCTAGCGGTCTGCTTGGTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneH3f3b (a.k.a. 9430068D06Rik, H3-3a, H3-3b, H3.3B)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186941-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186941-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-H3f3b KO sgRNA was a gift from Zhiguo Zhang (Addgene plasmid # 186941 ; http://n2t.net/addgene:186941 ; RRID:Addgene_186941) -
For your References section:
Stable inheritance of H3.3-containing nucleosomes during mitotic cell divisions. Xu X, Duan S, Hua X, Li Z, He R, Zhaang Z. Nat Commun. 2022 May 6;13(1):2514. doi: 10.1038/s41467-022-30298-4. 10.1038/s41467-022-30298-4 PubMed 35523900