CMV-hCas9-T2A-mStrawberry
(Plasmid
#187224)
-
PurposeExpresses human Cas9 nuclease and mStrawberry via T2A linker under control of a CMV promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.3-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6390
- Total vector size (bp) 10533
-
Modifications to backboneInserted T2A-mStrawberry at 3' terminal of MCS.
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4140
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- Inserted T2A-mStrawberry at 3' terminal of MCS. (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGAAGACACCGGGACCGAT
- 3′ sequencing primer GGATTCTCCTCCACGTCACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9 was subcloned from Addgene Plasmid #41815 (hCas9 from George Church)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-hCas9-T2A-mStrawberry was a gift from Jennifer Mitchell (Addgene plasmid # 187224 ; http://n2t.net/addgene:187224 ; RRID:Addgene_187224) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673